Schwammern ist schön

Zur Schwammer-Übersicht

09.09.2
017: Viele Erstfunde, schwer Bestimmbares und Leckereien - Teil 2

Liebe Pilz-Freunde,
dies ist Teil 2 des Berichtes vom 09.09.2017.

Teil 1 findet Ihr hier
Teil 3 findet Ihr hier

Und weiter geht's...

Fundnummer: 2017-09-09-1405
Die Art finde ich nicht sehr oft, hier aber in Massen. Auch wenn wegen Maden nicht so viel für die Pfanne blieb, die Fotos verderben einem die Viecher wenigstens nicht.
Edel-Reizker (Lactarius deliciosus):


















Fundnummer: 2017-09-09-1412

Morphologische Daten:

Fundort: ca. 550 müNN. ca. N50, O12, bei Birke und Kiefer
Fundzeit: 09.09.2017
Wuchsform: einige am Standort
Hutform:
schwach konvex bis flach, verbogen
Huthaut:
braun, nach außen hin deutlich heller werdend, unter Lupe netzartig gefasert, etwas klebrig
Huthaut-Abziehbarkeit:
1/2 abziehbar
Hygrophanität: nicht untersucht
Hutrand:
ist zwar nicht gerippt aber aber die Durchscheinenden Lamellen lassen es so aussehen, kantig
Lamellen:
gelblich, Zwischenlamellen
Lamellenschneiden:
bräunlich, braunfleckend
Lamellen-Stielübergang:
fast ausgebuchtet angewachsen aber eher gerade
Stiel: bräunlich längs überfasert, oben bereift, keulig aber Basis spitz zulaufend, längsfaserig, hohl
Stielbasis: spitz
zulaufend
Fleisch:
im Stiel hellgelb mit bräunlichem Zentrum, im Hut weiß mit bräunlichem Zentrum
Größe: Hutdurchmesser ca.
6-9 cm, Stiellänge ca. 5-7 cm Stieldurchmesser an der dicken Stelle 1,2-2 cm
Sporenpulverfarbe:
rein weiß
Geruch: unzerrieben & zerrieben: mehlig
Geschmack:
mehlig, unangenehm, ganz leicht bitterlich

Wegen er Hutrandrippung, dem Geschmack und dem Geruch ist das der
Gelbblättrige Ritterling (Tricholoma fulvum):









Fundnummer: 2017-09-09-1431
Auch ein wunderbarer Erstfund für mich:
Violetter Becherling (Peziza violacea)
:






Asci:






Fundnummer: 2017-09-09-1437

Morphologische Daten:
Fundort:
ca. 550 müNN. ca. N50, O12, bei Fichte und Birke
Fundzeit: 09.09.2017
Wuchsform: gesellig
Hutform:
konvex
Huthaut-Konsistenz: glatt, etwas glänzend
Huthaut-Farbe:
fleischrosa bis zu grauweiß ausgeblasst, glänzend,
Huthaut-Abziehbarkeit:
1/4 bis 1/3 abziehbar
Fleischfarbe unter Huthaut
:
rosa
Hut-Fraßstellen-Rand-Verfärbung: keine vorhanden
Hutrand:
kantig, nicht gerieft
Lamellen:
cremeweiß, mit Zwischenlamellen
Lamellenschneiden: ohne Besonderheiten
Lamellensprödigkeit:
nicht besonders spröde
Lamellen-Stielübergang:
gerade angewachsen
Stiel:
weiß,
leicht grauend, etwas runzelig, etwas keulig, voll, nicht wattig ausgestopft
Stielbasis:
rund
Fleisch: ohne Besonderheiten
Größe:
Hutdurchmesser bis 5 cm, Stiellänge 2-4 cm, Stieldurchmesser ca. 7-12 mm
Sporenpulverfarbe:
am ehesten: IId im direkten Vergleich mit der Marxmüller-Tafel, IIIa im direkten Vergleich mit der Romagnesi-Tafel
Geruch: absolut neutral
Geschmack:
scharf aber erträglich und scharf bleibend

Makrochemische Reaktionen:
Guajak: nach 20 Sek. blaugrün, nach 25 sek. stark blaugrün
Anilin pur: keine Reaktion
Eisensulfat FeSo4: keine Reaktion
Phenol: nach 2 Minuten blass-rosa, nach 5 Minuten weinrot
KOH 40%: keine Reaktion

Nicht häufig bei uns: der
Verblassende Täubling (Russula exalbicans):



Fundnummer: 2017-09-09-1510

Morphologische Daten:

Fundort: ca. 550 müNN. ca. N50, O12, bei Birke und Weide auf Laubstreu und Ästchen
Fundzeit: 09.09.2017
Wuchsform: gesellig bis büschelig
Hutform:
Mitte vertieft
Huthaut:
cremeweiß, mit rosa Schimmer, matt, trocken
Hutrand:
gerieft, mehlig bereift, flattrig, kantig, feinst eingerollt
Lamellen:
cremeweiß, sehr viele Zwischenlamellen, sichelförmig
Lamellenschneiden:
vollkommen glatt auch unter der Lupe
Lamellen-Stielübergang:
herablaufend
Stiel:
weiß und rosalich, innen etwas weichlich ausgestopft
Stielbasis:
weiß, stark myzelfilzig, rund bis etwas spitz zulaufend
Fleisch:
weiß, ganzer Pilz sehr elastisch gummiartig
Größe:
Hutdurchmesser 2-5 cm, Stiellänge ca. 3 cm, Stieldurchmesser ca. 5 mm
Sporenpulverfarbe:
rein weiß
Geruch: am Fundort: nur pilzig, zuhause: pilzig und etwas süßlich fruchtig
Geschmack:
sehr stark irgendwie "nicht gut pilzig ranzig"

Auch ein sehr schöner Erstfund:
Weißer Holztrichterling (Clitocybe truncicola)
:


















Fundnummer: 2017-09-09-1526

Morphologische Daten:

Fundort:
ca. 550 müNN. ca. N50, O12, bei
Pappel, Birke, Weide und Fichte
Fundzeit: 09.09.2017
Wuchsform: einige am Standort
Hutform:
kugelig bis konvex
Huthaut:
graubraun, samtig
Hutrand: ohne Besonderheiten
Röhren:
grau-cremefarben, auf Druck: verfärben zu grau
Stiel:
schwärzliche Flocken auf weißem Grund, keulig
Stielbasis: rund,
Fraßstellen blau
Fleisch-Verfärbung:
nach 2 Minuten im Hutfleisch rosa-rötlich und im Stiel und Basis tut sich zunächst nichts, nach 40 Minuten: Violett im Hutfleisch und nach unten rötlich
Geruch: im Schnitt harzig

Der
Pappel-Raufuß (Leccinum duriusculum):






Hier seht ihr mal die Verfärbung im Fleisch:









Fundnummer: 2017-09-09-1539
Voucher: DW201709091539

Matthias schrieb dazu im Jahr 2017:
Dieses braune Graublatt ist für mich aktuell nicht bestimmbar. Mit der Sporengröße kann man alles ausschließen. T. cessans kommt noch hin, aber auch für den sind die Sporen zu klein, zu länglich und es fehlen die Zystiden. Das was ich optisch gedacht hätte (inolens/boudieri) hätte alles deutlich größere Sporen, der hier hat Sporen konstant unter 6µm Länge.

Im Jahr 2023 kamen wir dann endlich dazu die Sequenzierung zu machen.
Hier der verkürzte Bericht dazu:

Auswahl der Loci für die Sequenzierung
Die Familie Lyophyllaceae ist nur lückenhaft phylogenetisch geklärt. Es sind kaum Sequenzdaten für die höhere Phylogenie vorhanden. Allerdings liegen bereits einige Sequenzdaten für die niedere Phylogenie vor. Manchmal reicht die Aufnahme der ITS1/2 aus, manchmal nicht.
Deshalb wurde zu Beginn nur die ITS1/2 sequenziert. Als Primer wurde zunächst der ITS4 Primer verwendet, welcher auch funktionierte.

Prüfung der Rohdaten
Nach der DNA-Extraktion, Amplifikation und Sequenzierung lagen die Rohdaten als Rückwärtssequenz vor.
Das Reverse Complement der Rohdaten wurde zunächst optisch am ITS Chromatogramm geprüft:

Es lag keine Dachschräge und kein kein sudden drop vor, der Verlauf war einwandfrei.

Anhand der Confidence Scores der Rohdaten wurden unsichere Sites ermittelt:

Die gelben Bereiche sind schlechte Confidence-Scores.
Die grünen Bereiche sind potentielle Polymorphe.
Diese Sites müssen geprüft werden (siehe nachfolgend).

ITS-Sequenzsammlung
Die ITS-Sequenzsammlung wird um Zeit zu sparen gleich für folgende Analyse-Schritte durchgeführt:

Quellenauswahl für die Sequenzsammlung: Die ITS-Sequenzen werden gesammelt von NCBI und Unite.
Es wurden insgesamt 1200 ITS-Sequenzen gesammelt. Davon 745 von Environmental Samples. In der Ingroup verblieben am Ende aber nur 17 und in der Outgroup nur 3. Die große Menge war für die nachfolgenden Prüfungen erforderlich und wurde dann weiter auf die Menge für das finale Phylogramm reduziert.

Prüfung und Korrektur der Rohsequenz und Basecalling
Für die Divergenz-Matrix konnten alle Sequenzen der Ingroup verwendet werden.
Als Alignisierungs-Software wurde Mafft Version 7.520 gewählt. Als Aliginisierung-Strategie wurde FFT-NS-2 welche für die Divergenz-Matrix völlig ausreicht.
Das Ergebnis der Prüfung der Rohsequenz:
Anfang: CTTCTTTGGTTTCCCA muss gelöscht werden; TTAGAG ist korrekt.
Site 528: korrekt – ist ein G
Site 529: Ist ein Problem. T kommt nicht vor in der kompletten Matrix, C kommt bei naheliegenden vor. In den Environmentals fehlt die Base weil zu kurz. Da unklärbar, Polymorph, C oder T. Polymorph – geändert auf Y
Site 530: korrekt – ist ein A
Site 605: korrekt – ist ein T
Site 606: korrekt – ist ein G
Site 611: korrekt – ist ein A
Site 625: korrekt – ist ein T
Site 628: korrekt – ist ein C
Site 631: korrekt – ist ein C
Ende: Nur NGNNNNNNN muss gelöscht werden, Rest ist OK

Die finale ITS-Sequenz des Fundes lautet somit:
>DW201709091539_final
TTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAATAAACTTGGTTAGGTT
GTTGCTGGCTCCTTGGAGCATGTGCACGCCTAGCACCAATTTTACCACCTGTGCACCTTTTGTAGACTTTGGAGTGCTTG
CGCTCCATAGTTTATGTCTTCACATATACACATGAATGTAACAGAATGTCATTAACGGGCCATTTAGTGCCTTTACAAAT
GAAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATT
GCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTC
ATTAAATTCTCAACCTTTTCAACTTTTGTTAGTTGCTCAGGCTTGGATTGTGGGGGTTGCGGGCTTCTCGGAAGTCGGCT
CTCCTTAAATACATTAGCAGAAACCTTTGTTGYATTAGCTCCGGCGTGATAATTATCTACGCCGTATGTGAAACAACTCT
TATACGGTTTAGCTTTCTAATAGTCCTTTGGGACAAACTCTTGACAATTGACCTCAAATCAGGT

GenBank Eintrag
Die Sequenz wurde bei GenBank hinterlegt:
https://www.ncbi.nlm.nih.gov/nuccore/OQ826527

Vorprüfung, Aussortierung und Erstellen des finalen Alignments
Der Fund landet in eine Klade die zwar phylogenetisch klärbar ist, aber noch nicht korrekt kombiniert ist. Wir überlegten, ob wir diese Klärung in Zuge der Fundanalyse machen. Zur eindeutigen Klärung müsste ein Supertree berechnet werden. Er zeitliche Aufwand ist so groß, dass wir dies derzeit nicht angehen können. Wir beschränkten uns deshalb auf die reine Fundbestimmung.
Entsprechend haben wir den sehr großen Baum auf die minimal nötige Klade beschränkt und 3 Taxa für die Outgroup belassen.
Die verbleibenden Sequenzen wurden neu aligined mit Prank (ohne Switches).

Folgende Liste zeigt die verbleibenden Sequenzen im Alignment:


Gap-Coding
Für das Gap-Coding wurden die Indel-Matrizen gecoded.
Für die vorliegende Studie wurde das SIC-Verfahren „Simple Indel Coding“ gewählt. Als Codiersoftware wurde SeqState gewählt.

Partitionierung
Für diese sehr einfach Studie wurde die ITS nicht weiter partitioniert. Es wurden also nur 2 Partitionen verwendet

Phylogrammberechnung
Das finale Phylogramm wurde mit RAxMLberechnet.
Evolutionsmodell DNA: GTR+G
Evolutionsmodell Indels: BINARY+G+A
Correct for Ascertainment bias: Ja, nach Paul Lewis

Finales Phylogramm
Der berechnete best tree wurde übersetzt und gerootet an der finalen Outgroup. Die Knoten <50% wurden kollabiert. Die Outgroup wurde ebenso kollabiert.
Finales Ergebnis:


Bestimmung des Fundes und Hinweis zu den noch fehlerhaften Gattungsnamen
Da die Klade in der sich der Fund befindet sich phylogenetisch deutlich von den anderen trennen lässt kann der Fund eindeutig zugeordnet werden.
Allerdings kann "Tephrocybe" confusa nicht zur Gattung Tephrocybe gehören, genauso wie "Lyophyllum" turcicum nicht zu Lyophyllum gehört. Dies ist deshalb so, weil der phylogenetische Abstand zu hoch ist, sich eine große Deletion in der Klade /confusa befindet und die Kladen durch andere Gattungen (z.B. Hypsizygus, Atractosoprocybe und Leucocybe) eben von Tephrocybe und Lyophyllum abgetrennt sind.
Wir belassen die Namen so, weil sie derzeit so gültig sind. Vielleicht findet jemand mal die Zeit um hier eine Neuordnung anzugehen.
Unabhängig davon ist jedoch eine Sache sicher: Alle Funde in der Klade sowie unser Fund sind nur eine einzige Art. Ohne den Typus von "Tephrocybe" confusa sequenziert zu haben ist der Name der Klade zwar nicht 100% sicher aber sehr, sehr wahrscheinlich. Wir können unseren Fund also guten Gewissens "Tephrocybe" confusa benennen.

Und hier seht Ihr nun den Fund: Dickstieliges Graublatt ("Tephrocybe" confusa):






HDS - genauer: Hauptsächlich die Schichten unterhalb der eigentlichen HDS:



Sporen:



Fundnummer: 2017-09-09-1542
Hier wieder mal ein Beispiel dafür, dass M. limosus nicht nur an Schilf/Rohrglanzgras vorkommt. Hier wuchsen die Pilzchen auf einem grasigen, sehr feuchten Waldweg. Man muss aber schon sehr genau hinsehen, um sie zu entdecken.
Schilf-Schwindling (Marasmius limosus)
:









Weiter zum Teil 3

Impressum & Datenschutz